[ Search ] - [ Help ] - [ FAQ ] - [ Release Notes ] - [ Contact Us ] - [ IMAGE Home ]

Overview

You can link to IMAGENE and have it search for your data using any of the search methods available.  Linking to IMAGEne is done through CGI.

There are 4 search parameters which control the Imagene search.  Each of these parameters have english - like values as seen by our users.  Each of these search parameter / value pairs have corresponding CGI parameter/value pairs that are provided to the CGI script called "search_results".  As demonstrated in the table below:

Examples

Here are examples of some hotlinks (which could be dynamically generated by CGI scripts):

<a href="http://image.llnl.gov/image/imagene/current/bin/search_results?by=keyword&query=interleuk&species=human">Click here to see the clusters that are related to Interleukin. Aligned by Clones.</a>
Click here to see the clusters that are related to Interleukin. Aligned by Clones.

<a href="http://image.llnl.gov/image/imagene/current/bin/search_results?by=clone&query=510700&species=human">Click here to see the cluster that contains I.M.A.G.E. clone 510700. Aligned by Clones.</a>
Click here to see the cluster that contains I.M.A.G.E. clone 510700. Aligned by Clones.

<a href="http://image.llnl.gov/image/imagene/current/bin/search_results?by=accession&query=NM_000206&species=human">Click here to see the cluster that contains I.M.A.G.E. clone 510700. Aligned by ESTs.</a>
Click here to see the cluster that contains the gene with GenBank accession NM_000206. Aligned by ESTs.

<a href="http://image.llnl.gov/image/imagene/current/bin/search_results?by=sequence&query=ctcgggccctgcccgcagagctctctgtcctagggcctggcggcagttacacaccatctaccagtctgtggaggcccctcagccctttgtaaagtctgatgaaggcaggggtggtgattcatgctgtgtgactgactgtgggtaataaacacacctgtccccc&cutoff=184&species=human">Click here to see the cluster that contains the sequence "ctcgggccctgcccgcagagctctctgtcctagggcctggcggcagttacacaccatctaccagtctgtggaggcccctcagccctttgtaaagtctgatgaaggcaggggtggtgattcatgctgtgtgactgactgtgggtaataaacacacctgtccccc".<A>Aligned by Clones.</a>
Aligned by Clones.

To take the user directly to the alignments screen of a given gene you need only call the "display" script and pass the "show" variable and one called "gbid".

<a href = "http://image.llnl.gov/image/imagene/current/bin/display?show=clone&gbid=NM_022721&species=mouse">Click here to go directly to the alignments screen of the gene NM_022721 for mouse. Aligned by Clones.</a>
Click here to go directly to the alignments screen of the gene NM_022721 for mouse. Aligned by Clones.

Of course any of the previous information can be applied to a CGI FORM such as the one used by the main search page (click below and use your Browser's "view source" feature to examine the HTML code).