1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers Recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Reference for library construction: Gene 200, 149-156, 1997. Note: this is a Zebrafish Gene Collection library.

Directionally cloned. Tissue source: brain tissue from pooled adults of both sexes. Library constructed by J. Ngai.

Library is cloned directionally between the DraIII(X) and DraIII(Y) sites and has been amplified. Library constructed by S. Lin.

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer. Library was constructed in a ZAP phage vector (Stratagene) using 5' and 3' linker adaptors. Average insert size 1.7 kb. Library constructed by Dr. Bruce Appel and Dr. Judith Eisen (University of Oregon).

1st strand cDNA was primed with an oligo(dT) primer. Library was constructed in the Hybri-ZAP vector (Stratagene) using 5' and 3' linker adaptors. Average insert size 1.7 kb. This library was constructed bymembers of the laboratories of Dr. P. Hackett, Dr. M. Halpern, and Dr. S. Ekker.

1st strand cDNA was primed with an oligo(dT) primer. Library was constructed in the Hybri-ZAP vector (Stratagene) using 5' and 3' linker adaptors. Average insert size 1.5 kb. This library was constructed bymembers of the laboratories of Dr. P. Hackett, Dr. M. Halpern, and Dr. S. Ekker.

1st strand cDNA was primed with an oligo(dT) primer. Library was constructed in the Hybri-ZAP vector (Stratagene) using 5' and 3' linker adaptors. Average insert size 1.2 kb. This library was constructed by members of the laboratories of Dr. P. Hackett, Dr. M. Halpern, and Dr. S. Ekker.

Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Average insert size 2 kb. For PCR insert analysis use forward and reverse primers. Library amplified recombinants (inserts): 98%; library complexity:5x10E6; full-length construction method: SMART (Clontech). Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).

Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Clones with high hybridization signals were selected as they represented highly abundant expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the highly abundant class ranged from 210,000 to 1.8 million. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).

Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Medium intensity clones were selected as they represented modest abundant expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the medium abundant class ranged from 25,000 to 50,000. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).

Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Low intensity clones were selected as they represented rare expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the low abundance class ranged from 0 to 13,000. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2 kb. Constructed by J. Wang (Research Genetics, Invitrogen Corp) from tissue donated by L. Zon (Harvard University). Note: this is a Zebrafish Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by J. Wang (Research Genetics, Invitrogen Corp) from tissue donated by L. Zon (Harvard University). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.9 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

Library constructed using oligo-dT/NotI primer and cloned into EcoRI/NotI sites. This library consists of unique clones fingerprinted and picked from RZPD library 567. Fingerprinting and arraying by M. Clark (Max Planck Institute, Berlin). Library name in dbEST is Zebrafish_WashU_MPIMG_EST.

First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb, and is not amplified. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: This is a Zebrafish Gene Collection (ZGC) library

Library constructed by and donated by Susan E. Brockerhoff, University of Washington (sbrocker@u.washington.edu).

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.92 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.85 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggtaacaacgcagagtacttt-ttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

Cloned unidirectionally. Primer: Oligo dT. Library constructed by Ning Wu (Research Genetics, Huntsville, AL).

First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

First strand cDNA primed with 5'-GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3', followed by second strand synthesis, and ligated to 5' adaptors: 5'-AATTCGGCACGAG-3' and 3'-GCCGTGCTC-5'. cDNA was cloned directionally into ZAP-express lambda phage arms (Stratagene) and in vivo mass excised to obtain inserts in pBK-CMV phagemid. Library preparation by R. Lee.

First strand cDNA primed with 5'-GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3', followed by second strand synthesis, and ligated to 5' adaptors: 5'-AATTCGGCACGAG-3' and 3'-GCCGTGCTC-5'. cDNA was cloned directionally into ZAP-express lambda phage arms (Stratagene) and in vivo mass excised to obtain inserts in pBK-CMV phagemid. Library preparation by R. Lee.

1st strand cDNA was primed with an oligo(dT) primer 5'-GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to a DraIII adaptor 5'-GGCCUACUGG-3', digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for >1.0 kb, with a average insert size of ~1.2 kb and is not amplified. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Reference for library construction: Methods Mol Bio 221:73-91. Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

Cloned unidirectionally. Primer: Oligo dT. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Library constructed by Dr. D. Stainier (University of California, San Francisco).

Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Constructed by J. Wang (Research Genetics, Invitrogen Corp) from tissue donated by L. Zon (Harvard University). Note: this is a Zebrafish Gene Collection library.

Oligo dT cDNA library constructed from mRNA pooled from kidneys from 300 adult zebrafish. Library prepared by L. Zon.

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers Recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Reference: Gene 200, 149-156, 1997. Note: this is a Zebrafish Gene Collection library.

Oligo-dT primed cDNA was produced from intestine (two independent samples) and liver using 5'-GAGAGAGAGAAGGATCCAAXXXXXXTTTTTTTTTTTTTTTTVN-3' with the following tags substituting for XXXXXX: CAAGAG (tag C04): liver; CGGTAT (tag C12): intestine; and CGTATG (tag D01): intestine. cDNA was pooled and size- selected for a 1.6 kb average insert. Library was constructed using the Cap- Trapper method as described in Genomics 2001: 77(1-2)79-90. Library donated by M. Pack, M.D. (University of Pennsylvania School of Medicine).

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

Directionally cloned. Tissue source: olfactory tissue from pooled adults of both sexes. Library constructed by J. Ngai.

Whole ovaries collected from zebrafish aged 4-5 months, 1 year and 2 years. Oligo-dT primed, directionally cloned. Average insert size 2 kb. Library constructed by Invitrogen and donated by R. Campbell (Marine Biology Laboratory, Woods Hole, MA).

Poly A+ RNA was isolatd from the ovaries of 2 female adult zebrafish (4-5 month old). cDNAs were made using oligo-dT primers and inserted into lambda ZAP II vector (Stratagene) by Dr. Z. Gong, in vivo mass-excised to pBluescript SK- following the Washington University protocol (http://genome.wustl.edu/est/lambda_protocol.shtml). Please contact Zhiyuan Gong for further information on this library (National University of Singapore, Department of Biological Sciences, Lower Kent Ridge Road, Singapore 119260).

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for for an average insert size of 1.45 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer 5'-GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to a DraIII adaptor 5'-GGCCUACUGG-3', digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for >1.0 kb, with a average insert size of ~1.2 kb and is not amplified. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Reference for library construction: Methods Mol Bio 221:73-91. Note: this is a Zebrafish Gene Collection library.

Poly A+ RNA was isolatd from the testes of 31 male adult zebrafish (4-5 month old). cDNAs were made using oligo-dT primers and inserted into lambda ZAP II vector (Stratagene) by Dr. Z. Gong, in vivo mass-excised to pBluescript SK- following the Washington University protocol (http://genome.wustl.edu/est/lambda_protocol.shtml). Please contact Zhiyuan Gong for further information on this library (National University of Singapore, Department of Biological Sciences, Lower Kent Ridge Road, Singapore 119260).

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI (3') and EcoRV (5') sites of pExpress-1 (EcoRV site destroyed upon ligation). Library has an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: the tissue for this library was originally annotated as pharyngeal arch; however upon sequence analysis it is suspected that this is not the correct tissue source. We have changed tissue to unknown source. Note: this is a Zebrafish Gene Collection library.

ORFs flanked by multiple cloning sites (MCS) were amplified from fully sequence verified cDNA clones with PCR. Amplified products were separated by agarose gel electrophoresis, excised, purified and cloned into pDeliver01.1 using restriction digestion-ligation method. pDeliver01.1 is equivalent to Gateway pENTR221 vector. In addition to attL sites, there is also a pair of multiple cloning sites in between attL sites and ORFs. All clones were fully sequenced and verified. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggcttGAAGGAATTCGGTACC-ORF-CTCGAGTGCGGCCGCAacccagctttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to multiple cloning linker sequence. Clones from this library contain a stop codon, which is uniformed to be TAG. Clones were synthesized by Genecopeia (Germantown, MD) Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.

Bulk tissue was collected from a whole adult individual from the Tubergin strain. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double- stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for 1 kb fragments. A normalized version of this library is also available (NIH_ZGC_7). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.52 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.5 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

Bulk tissue was collected from a whole adult individual from the Tubergin strain. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for 1 kb fragments and normalized. A non-normalized version of this library is also available (NIH_ZGC_10). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed and donated by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA.

1st strand cDNA was primed with an oligo(dT) primer
[ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a
DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII
sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG).
XhoI should be used to isolate the cDNA insert. Size selection was
performed to exclude fragments <1.5kb. Library constructed and donated
by Dr. Sumio Sugano and Dr. Ko-ichi Kawakami (University of Tokyo Institute
of Medical Science).
Custom primers for sequencing: 5' end primer
CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA.
REFERENCES:
Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano,
S. Construction and characterization of a full length-enriched and a 5' end
enriched cDNA library. Gene 200, 149-156, 1997.

First strand cDNA was primed using an oligo-dT adaptor primer with an XhoI site: 5'-gagagagagagagagagagaactagtctcgagtttttttttttttttttt-3'. Double-stranded cDNA was ligated to an EcoRI adaptor: 5'-aattcggcacgagg-3' and was digested with XhoI and directionally cloned into pZero-2. Library construction by Joe Barnes and Steve Johnson (Washington University).

First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).