Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1.4 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.3 kp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.5 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.3 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.3 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.4 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 2 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 2.2 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.8 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.9 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 2.3kb. This is a non-normalized primary library and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400bp with average size 1.4 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >300 bp with average size 1120 bp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.1kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1.8 bp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1300 bp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 2.2 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.2 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.1 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using BamHI primer 5'-GAGAGAGAGAAAGGATCCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using XhoI primer 5'-GAGAGAGAGAGAGATTCTTCGAGTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pBluescript II SK+ vector. Library is size selected >400 bp with average size 890 bp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (3') and M13F (5'). Library constructed by J. Yu and S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.5 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.1kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 2.3 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1.1 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400bp with average size 1.5kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.

cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 2.4kb. This is a non-normalized library and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.